Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249478

Morpholino Name: ezh2 MO1
Synonyms: ezh2MO
Target mRNA: ezh2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTTCTTCCCCGTCTGGCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/22 22/22 20/22
genomic

MO
5' ATGGGCCAGACGGGCAAGAAAT 3' |||||||||||||| ||||||| 3' TACCCGGTCTGCCCCTTCTTTA 5' 5' ATGGGCCAGACGGGGAAGAAAT 3' |||||||||||||||||||||| 3' TACCCGGTCTGCCCCTTCTTTA 5' 5' ATGGGCCAGACAGGCAAGAAAT 3' ||||||||||| || ||||||| 3' TACCCGGTCTGCCCCTTCTTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:52983177..52983198 22/22 Antisense target ezh2.L
chr6S:46038333..46038354 20/22 Antisense target ezh2.S
Scaffold28:873425..873446 20/22 Antisense off-target kcnq5.L
chr4L:16702561..16702582 20/22 Sense off-target myrf.L
chr6S:10683177..10683198 20/22 Sense off-target rbm33.S
Scaffold28:873806..873827 19/22 Sense off-target kcnq5.L
chr1L:189733393..189733414 19/22 Sense off-target serinc5.L
chr1L:71060849..71060870 19/22 Sense off-target grid2.L
chr2L:119705660..119705681 19/22 Antisense off-target pcca.L
chr3L:107611796..107611817 19/22 Sense off-target igdcc3.L
chr3L:36986215..36986236 19/22 Sense off-target stk32a.L
chr4L:103784015..103784036 19/22 Sense off-target LOC108713552 [provisional:f13b]
chr4L:104111613..104111634 19/22 Sense off-target cfh.L
chr4L:42346080..42346101 19/22 Sense off-target cmip.L
chr5L:125231193..125231214 19/22 Antisense off-target plekhb2.L
chr5L:42758518..42758539 19/22 Sense off-target LOC108716663 [provisional:adgrg6]
chr5L:89100464..89100485 19/22 Sense off-target cyp3a4.2.L
chr5L:89100464..89100485 19/22 Sense off-target cyp3a4.1.L
chr8L:21265653..21265674 19/22 Sense off-target LOC108698313 [provisional:rab6b]
chr9_10L:40395406..40395427 19/22 Sense off-target foxk2.L
chr9_10L:52540413..52540434 19/22 Sense off-target LOC108701300
chr9_10L:52540413..52540434 19/22 Antisense off-target wnt10a.L
chr1S:178164062..178164083 18/22 Antisense off-target LOC108705540 [provisional:celf4]
chr5L:80581236..80581257 18/22 Antisense off-target crybg1.L
chr5L:153029050..153029071 20/22 unknown
chr8L:102235212..102235233 20/22 unknown
Scaffold111:256297..256318 19/22 unknown
chr1L:144708863..144708884 19/22 unknown
chr2L:50229960..50229981 19/22 unknown
chr4L:107617809..107617830 19/22 unknown
chr4L:27491942..27491963 19/22 unknown
chr5L:131954673..131954694 19/22 unknown
chr6L:153895796..153895817 19/22 unknown
chr6L:20456261..20456282 19/22 unknown
chr8L:5119907..5119928 19/22 unknown
chr9_10L:73148326..73148347 19/22 unknown
chr1L:57428152..57428173 18/22 unknown
chr2L:160276410..160276431 18/22 unknown
tropicalis 10.0 Chr6:55142664..55142685 21/22 Antisense target ezh2
Publications
First: Geminin cooperates with Polycomb to restrain multi-lineage commitment in the early embryo., Development 2011                      
Most recent:
View All Papers