Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249479

Morpholino Name: ezh2 MO2
Synonyms: Ezh2MO
Target mRNA: ezh2

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGATTTCTTCCCCGTCTGGCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' ATGGGCCAGACGGGCAAGAAATCTG 3' |||||||||||||| |||||||||| 3' TACCCGGTCTGCCCCTTCTTTAGAC 5' 5' ATGGGCCAGACGGGGAAGAAATCTG 3' ||||||||||||||||||||||||| 3' TACCCGGTCTGCCCCTTCTTTAGAC 5' 5' ATGGGCCAGACAGGCAAGAAATCTG 3' ||||||||||| || |||||||||| 3' TACCCGGTCTGCCCCTTCTTTAGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:52983177..52983201 25/25 Antisense target ezh2.L
chr6S:46038333..46038357 23/25 Antisense target ezh2.S
Scaffold28:873425..873449 22/25 Antisense off-target kcnq5.L
chr4L:16702561..16702585 22/25 Sense off-target myrf.L
Scaffold28:873803..873827 21/25 Sense off-target kcnq5.L
chr1S:117215784..117215808 21/25 Antisense off-target znf219.S
chr2L:119705657..119705681 21/25 Antisense off-target pcca.L
chr3L:107611796..107611820 21/25 Sense off-target igdcc3.L
chr3L:36986215..36986239 21/25 Sense off-target stk32a.L
chr4L:103784015..103784039 21/25 Sense off-target LOC108713552 [provisional:f13b]
chr4L:42346080..42346104 21/25 Sense off-target cmip.L
chr5L:125231190..125231214 21/25 Antisense off-target plekhb2.L
chr5L:42758518..42758542 21/25 Sense off-target LOC108716663 [provisional:adgrg6]
chr5L:80581233..80581257 21/25 Antisense off-target crybg1.L
chr5L:89100464..89100488 21/25 Sense off-target cyp3a4.2.L
chr5L:89100464..89100488 21/25 Sense off-target cyp3a4.1.L
chr5S:4873065..4873089 21/25 Sense off-target macrod2.S
chr1L:189733393..189733417 21/25 Sense off-target serinc5.L
chr1L:71060849..71060873 21/25 Sense off-target grid2.L
chr6S:10683174..10683198 21/25 Sense off-target rbm33.S
chr7L:26511970..26511994 21/25 Antisense off-target pprc1.L
chr7L:73438323..73438347 21/25 Sense off-target pdzd3.L
chr9_10L:40395403..40395427 21/25 Sense off-target foxk2.L
chr9_10L:52540410..52540434 21/25 Sense off-target LOC108701300
chr9_10L:52540410..52540434 21/25 Antisense off-target wnt10a.L
chr6L:89625916..89625940 21/25 Sense off-target hivep1.L
chr5L:153029050..153029074 22/25 unknown
Scaffold111:256297..256321 21/25 unknown
chr1L:144708860..144708884 21/25 unknown
chr2L:50229960..50229984 21/25 unknown
chr4S:101949028..101949052 21/25 unknown
chr5L:131954673..131954697 21/25 unknown
chr6L:20456258..20456282 21/25 unknown
chr8L:5119907..5119931 21/25 unknown
chr9_10L:73148323..73148347 21/25 unknown
tropicalis 10.0 Chr6:55142664..55142688 24/25 Antisense target ezh2
Chr7:32137501..32137525 21/25 Antisense off-target pprc1
Publications
First: Geminin cooperates with Polycomb to restrain multi-lineage commitment in the early embryo., Development 2011                      
Most recent:
View All Papers