Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249480

Morpholino Name: f2rl1 MO1
Synonyms: PAR-2
mRNA Target: f2rl1

Morpholino Type:
Sequence:
5' GCCTCCAGACACCCATGTCCTTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GGAAAGGACATGGGGGACTGGCGGT 3' |||||||||||||| | |||| || 3' CCTTTCCTGTACCCACAGACCTCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold32212:6149290-6149314 24/25 Antisense off-target Xelaev16042869m
Scaffold115163:1512693-1512717 21/25 Sense off-target Xelaev16004239m
Scaffold17434:1351024-1351048 21/25 unknown
Scaffold96712:1361609-1361633 21/25 unknown
tropicalis 7.1 scaffold_1:16969620-16969644 21/25 Antisense target f2rl1
Publications
First: Indirect activation of the epithelial Na+ channel by trypsin. [J Biol Chem 2007]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556