Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249481

Morpholino Name: fam102a MO1
Synonyms: MO7 (1363-1387)
mRNA Target: fam102a

Morpholino Type:
Sequence:
5' TACAAAAAAAGTGCAATAACAAGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' CATTTGTTATTGCACTTTTTTGTGA 3' || |||||||||||||||||| | 3' GTGAACAATAACGTGAAAAAAACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15893:211184..211208 22/25 unknown
Scaffold7940:408704..408728 22/25 unknown
Scaffold98999:3514833..3514857 22/25 Sense off-target Xelaev16080855m
Scaffold133382:1289808..1289832 21/25 unknown
Scaffold4321:919891..919915 21/25 unknown
Scaffold83106:2624909..2624933 21/25 Antisense off-target aplp2.L
Scaffold86871:707999..708023 21/25 unknown
tropicalis 7.1 scaffold_1:202285376..202285400 21/25 unknown
scaffold_3:61593992..61594016 21/25 unknown
scaffold_4:139933067..139933091 21/25 Antisense target fam102a
scaffold_8:90486559..90486583 21/25 unknown
Publications
First: Participation of Xenopus Elr-type proteins in vegetal mRNA localization during oogenesis. [J Biol Chem 2009]
Most recent: Elr-type proteins protect Xenopus Dead end mRNA from miR-18-mediated clearance in the soma. [Proc Natl Acad Sci U S A 2010]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556