Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249482

Morpholino Name: fam3c MO1
Synonyms: XFAM3C MO
mRNA Target: fam3c

Morpholino Type:
Sequence:
5' CTTTATGGCACCTGCTATCCTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold127187:293606-293630 21/25 unknown
Scaffold137809:244408-244432 21/25 Antisense off-target katnb1.L
Scaffold21603:3752021-3752045 21/25 unknown
Publications
First: Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. [Biochem Biophys Res Commun 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556