Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249483

Morpholino Name: fam92a1 MO1
Synonyms: xVAP019
mRNA Target: fam92a

Morpholino Type:
Sequence:
5' TCTGGCTCATTGTGACAGGGTCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold34503:4125093..4125117 25/25 Antisense off-target Xelaev16045175m
Scaffold6529:2649792..2649816 22/25 unknown
tropicalis 7.1 scaffold_7:14863509..14863533 21/25 unknown
scaffold_89:11481..11505 21/25 unknown
Publications
First: Isolation and characterization of a novel Xenopus gene (xVAP019) encoding a DUF1208 domain containing protein. [Mol Reprod Dev 2007]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556