Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249484

Morpholino Name: fbn3 MO1
Synonyms: XF
mRNA Target: fbn3

Morpholino Type:
Sequence:
5' GCCTATGTTATATGAACAGCAGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' TGCTGCTGTTCCTATAACATTGGC 3' ||||||||||| |||||||| ||| 3' ACGACGACAAGTATATTGTATCCG 5' 5' TGCTGCTGTTCATATAACATAGGC 3' |||||||||||||||||||||||| 3' ACGACGACAAGTATATTGTATCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold44247:446335-446358 24/24 Antisense target fbn3.L
Scaffold181141:337162-337185 23/24 Antisense off-target Xelaev16022024m
Scaffold23165:6899735-6899758 21/24 unknown
Scaffold403228:203419-203442 21/24 unknown
Scaffold203041:2362040-2362063 20/24 Sense off-target Xelaev16025909m
Scaffold39723:6485327-6485350 20/24 Sense off-target Xelaev16050724m
Scaffold43061:280665-280688 20/24 Sense off-target Xelaev16052727m
Scaffold5925:1068497-1068520 20/24 Sense off-target Xelaev16064646m
tropicalis 7.1 scaffold_1:136204557-136204580 22/24 Antisense target fbn3
scaffold_3:20073961-20073984 21/24 Antisense off-target fbn1
scaffold_6:25146988-25147011 21/24 unknown
scaffold_7:27078051-27078074 21/24 unknown
scaffold_1:175680116-175680139 20/24 unknown
scaffold_2:4743433-4743456 20/24 unknown
scaffold_3:43078871-43078894 20/24 Antisense off-target fgf6
Publications
First: Xenopus fibrillin regulates directed convergence and extension. [Dev Biol 2007]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556