Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249485

Morpholino Name: fbxl14 MO1
Synonyms: Ppa MO
mRNA Target: fbxl14

Morpholino Type:
Sequence:
5' AGACACGAGATGTGGGTCTCCATAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CCATGGAGACCCACATCTCATGCCT 3' | ||||||||||||||||| || || 3' GATACCTCTGGGTGTAGAGCACAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold256647:503775-503799 25/25 Sense off-target wnt5b.S
Scaffold58790:799171-799195 23/25 Antisense off-target Xelaev16064070m
tropicalis 7.1 scaffold_3:40760366-40760390 22/25 Antisense target fbxl14
Publications
First: Slug stability is dynamically regulated during neural crest development by the F-box protein Ppa. [Development 2006]
Most recent: The F-box protein Ppa is a common regulator of core EMT factors Twist, Snail, Slug, and Sip1. [J Cell Biol 2011]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556