Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249486

Morpholino Name: fbxo43 MO1
Synonyms: EMI2, Emi2 MO, Erp1, Erp1 antisense MO, Xerp1 MO1
mRNA Target: fbxo43

Morpholino Type:
Sequence:
5' AGATTTGCCATCTCTTGTTTCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' AAGAAACAAGAGATGGCAAATCT 3' ||||||||||||||||||||||| 3' TTCTTTGTTCTCTACCGTTTAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold62229:372674..372696 23/23 Antisense target fbxo43.L
Scaffold30987:4233257..4233279 21/23 unknown
Scaffold114457:170982..171004 20/23 unknown
Scaffold158000:27332..27354 20/23 Antisense off-target Xelaev16016658m
Scaffold18192:3139953..3139975 20/23 unknown
Scaffold3286:1050863..1050885 20/23 Antisense off-target trmu.L
Scaffold34503:3951951..3951973 20/23 Antisense off-target Xelaev16045170m
Scaffold402746:571401..571423 20/23 unknown
Scaffold81941:3302335..3302357 20/23 Sense off-target Xelaev16075031m
Scaffold167800:757261..757283 19/23 Sense off-target Xelaev16019277m
Scaffold58049:4482779..4482801 19/23 unknown
Scaffold61444:251988..252010 19/23 Antisense off-target Xelaev16066091m
Scaffold75966:1618569..1618591 19/23 unknown
tropicalis 7.1 scaffold_363:39763..39785 20/23 Sense off-target anapc4
scaffold_5:98528768..98528790 20/23 unknown
scaffold_6:132537104..132537126 20/23 unknown
scaffold_8:17530576..17530598 20/23 unknown
scaffold_1:146178478..146178500 19/23 unknown
scaffold_2:128219926..128219948 19/23 unknown
scaffold_2:88266370..88266392 19/23 Antisense off-target unnamed
scaffold_3:75184184..75184206 19/23 unknown
scaffold_9:35804470..35804492 19/23 unknown
scaffold_9:64368589..64368611 19/23 unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes. [Dev Biol 2007]
Most recent: The APC/C inhibitor XErp1/Emi2 is essential for Xenopus early embryonic divisions. [Science 2012]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556