Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249487

Morpholino Name: fbxo43 MO2
Synonyms: EMI2, Erp1, Xerp1 MO2
mRNA Target: fbxo43

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTGCCATCTCTTGTTTCTTTCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' GAAGAAAGAAGCAAGAGATGGCACA 3' |||||||||| |||||||||||||| 3' CTTCTTTCTTTGTTCTCTACCGTGT 5' 5' GAAGAAAGAAACAAGAGATGGCAAA 3' ||||||||||||||||||||||| | 3' CTTCTTTCTTTGTTCTCTACCGTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold34503:3951946..3951970 25/25 Antisense off-target Xelaev16045170m
Scaffold62229:372677..372701 24/25 Antisense target fbxo43.L
Scaffold48253:1917480..1917504 22/25 unknown
Scaffold81941:3302330..3302354 22/25 Sense off-target Xelaev16075031m
Scaffold11628:121..145 21/25 unknown
Scaffold11978:823137..823161 21/25 unknown
Scaffold167628:1287211..1287235 21/25 unknown
Scaffold185879:1036699..1036723 21/25 unknown
Scaffold25194:2644617..2644641 21/25 unknown
Scaffold29621:5485836..5485860 21/25 unknown
Scaffold30987:4233252..4233276 21/25 unknown
Scaffold4321:15337631..15337655 21/25 unknown
Scaffold46631:4666520..4666544 21/25 unknown
Scaffold71264:382513..382537 21/25 Sense off-target Xelaev16069807m
Scaffold87668:618130..618154 21/25 unknown
tropicalis 7.1 scaffold_6:21771866..21771890 24/25 Antisense target fbxo43
scaffold_101:104516..104540 21/25 unknown
scaffold_2:236315..236339 21/25 unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent: The APC/C inhibitor XErp1/Emi2 is essential for Xenopus early embryonic divisions., Science 2012  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556