Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249488

Morpholino Name: fbxo43 MO3
Synonyms: XErp1#1
mRNA Target: fbxo43

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGTCTGGGCTGAATCCCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/20 20/20
genomic

MO
5' AAGGGATTCAGCCCAGACTC 3' |||||||||||||||||||| 3' TTCCCTAAGTCGGGTCTGAG 5' 5' AAGGGATTCAGCCCAGACTC 3' |||||||||||||||||||| 3' TTCCCTAAGTCGGGTCTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold34503:3952095..3952114 20/20 Antisense off-target Xelaev16045170m
Scaffold62229:372548..372567 20/20 Antisense target fbxo43.L
Scaffold78978:1011031..1011050 18/20 Sense off-target scyl3.L
Scaffold402161:541704..541723 17/20 Sense off-target Xelaev16051459m
Scaffold9994:4554478..4554497 17/20 Antisense off-target Xelaev16081360m
tropicalis 7.1 scaffold_6:21772018..21772037 20/20 Antisense target fbxo43
scaffold_10:33295511..33295530 17/20 unknown
scaffold_9:84860844..84960080 17/20 Antisense off-target cfap70
scaffold_9:84860844..84960080 17/20 Antisense off-target wdr90
scaffold_1:103390586..103444318 16/20 Antisense unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556