Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249496

Morpholino Name: fgf13 MO2
Synonyms:
mRNA Target: fgf13

Morpholino Type:
Sequence:
5' AGAGAGCTGGCAATGGCCGCAGCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGCTGCGGCCATTGCCAGCTCTCT 3' ||||||||||||||||||||||||| 3' ACCGACGCCGGTAACGGTCGAGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12933:2412000..2412024 25/25 Antisense off-target Xelaev16008289m
Scaffold50694:4836332..4836356 24/25 Antisense off-target Xelaev16058647m
tropicalis 7.1 scaffold_8:48332958..48332982 25/25 Antisense target fgf13
Publications
First: Fibroblast growth factor 13 is essential for neural differentiation in Xenopus early embryonic development. [J Biol Chem 2007]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556