Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249496

Morpholino Name: fgf13 MO2
Synonyms:
mRNA Target: fgf13

Morpholino Type:
Sequence:
5' AGAGAGCTGGCAATGGCCGCAGCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGCTGCGGCCATTGCCAGCTCTCT 3' ||||||||||||||||||||||||| 3' ACCGACGCCGGTAACGGTCGAGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12933:2412000..2412024 25/25 Antisense off-target Xelaev16008289m
Scaffold50694:4836332..4836356 24/25 Antisense off-target Xelaev16058647m
tropicalis 7.1 scaffold_8:48332958..48332982 25/25 Antisense target fgf13
Publications
First: Fibroblast growth factor 13 is essential for neural differentiation in Xenopus early embryonic development., J Biol Chem 2007                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556