Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249499

Morpholino Name: fgf4 MO1
Synonyms: FGF4, eFGFMO, eFM, eFM MO
mRNA Target: fgf4

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGGAACAGTCATCCCGATCAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/23 21/23
genomic

MO
5' GTTGATCAGGATGACTGTTCCAT 3' ||||||| ||||||||||||||| 3' CAACTAGCCCTACTGACAAGGTA 5' 5' GTTGATCAGGATGACTGTTCAAT 3' ||||||| |||||||||||| || 3' CAACTAGCCCTACTGACAAGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold185603:195925..195947 23/23 Antisense off-target Xelaev16022894m
Scaffold43483:1094459..1094481 21/23 Antisense target fgf4.S
Scaffold15893:4924122..4924144 20/23 unknown
Scaffold3881:244795..244817 19/23 unknown
tropicalis 7.1 scaffold_4:10658449..10658471 22/23 Antisense target fgf4
scaffold_1:56055362..56055384 19/23 unknown
Publications
First: eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis., Development 2002      
Most recent: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556