Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249499

Morpholino Name: fgf4 MO1
Synonyms: FGF4, eFGFMO, eFM, eFM MO
Target mRNA: fgf4

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGAACAGTCATCCCGATCAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/23 23/23 21/23
genomic

MO
5' GTTGATCAGGATGACTGTTCCAT 3' ||||||| ||||||||||||||| 3' CAACTAGCCCTACTGACAAGGTA 5' 5' GTTGATCGGGATGACTGTTCCAT 3' ||||||||||||||||||||||| 3' CAACTAGCCCTACTGACAAGGTA 5' 5' GTTGATCAGGATGACTGTTCAAT 3' ||||||| |||||||||||| || 3' CAACTAGCCCTACTGACAAGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:8749231..8749253 23/23 Antisense target fgf4.L
chr4S:14372529..14372551 21/23 Antisense target fgf4.S
chr3L:15246983..15247005 20/23 Antisense off-target LOC108710837
chr2S:20273654..20273676 19/23 unknown
tropicalis 10.0 Chr4:12805875..12805897 22/23 Antisense target fgf4
Chr1:151923417..151923439 19/23 Sense off-target sppl3
Publications
First: eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis., Development 2002      
Most recent: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
View All Papers