Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249501

Morpholino Name: fgf8 MO2
Synonyms: Fgf8aMO, MOSAF8a
Target mRNA: fgf8

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCTGCTCCCTCACATGCTGTGTAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TTACACAGCATGTGAGGGAGCAGAG 3' ||||||||||||||||||||||||| 3' AATGTGTCGTACACTCCCTCGTCTC 5' 5' TTACACAGCATGTGAGGGAGCAGAG 3' ||||||||||||||||||||||||| 3' AATGTGTCGTACACTCCCTCGTCTC 5' 5' TTACACAGCATGTGAGGGAGCAGAG 3' ||||||||||||||||||||||||| 3' AATGTGTCGTACACTCCCTCGTCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:25380980..25381004 25/25 Antisense target fgf8.L
chr7S:20488549..20488573 25/25 Antisense target fgf8.S
tropicalis 10.0 Chr7:31019075..31019099 25/25 Antisense target fgf8
Publications
First: FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus., Development 2006              
Most recent: The activity of Pax3 and Zic1 regulates three distinct cell fates at the neural plate border., Mol Biol Cell 2007                  
View All Papers