Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249502

Morpholino Name: fgf8 MO3
Synonyms: FGF-8-AS, FGF8, FGF8 MO, FGF8-MO
mRNA Target: fgf8

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CCAGGATGGAGGTGATGTAGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAGCTACATCACCTCCATCCTGG 3' |||| |||||||||||||||||||| 3' TACTTGATGTAGTGGAGGTAGGACC 5' 5' ATGAACTACATCACCTCCATCCTGG 3' ||||||||||||||||||||||||| 3' TACTTGATGTAGTGGAGGTAGGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold33483:255054..255078 25/25 Antisense target fgf8.L
Scaffold1915:815525..815549 24/25 Antisense off-target Xelaev16024201m
Scaffold102277:1672627..1672651 21/25 unknown
tropicalis 7.1 scaffold_7:25554551..25554575 24/25 Antisense target fgf8
Publications
First: Ectopic EphA4 receptor induces posterior protrusions via FGF signaling in Xenopus embryos., Mol Biol Cell 2004  
Most recent: FGF is essential for both condensation and mesenchymal-epithelial transition stages of pronephric kidney tubule development., Dev Biol 2006                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556