Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249502

Morpholino Name: fgf8 MO3
Synonyms: FGF-8-AS, FGF8, FGF8 MO, FGF8-MO
Target mRNA: fgf8

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCAGGATGGAGGTGATGTAGTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGAGCTACATCACCTCCATCCTGG 3' |||| |||||||||||||||||||| 3' TACTTGATGTAGTGGAGGTAGGACC 5' 5' ATGAACTACATCACCTCCATCCTGG 3' ||||||||||||||||||||||||| 3' TACTTGATGTAGTGGAGGTAGGACC 5' 5' ATGAGCTACATCACCTCCATCCTGG 3' |||| |||||||||||||||||||| 3' TACTTGATGTAGTGGAGGTAGGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:25383699..25383723 25/25 Antisense target fgf8.L
chr7S:20491112..20491136 24/25 Antisense target fgf8.S
chr7S:20491112..20491136 24/25 Antisense off-target Xelaev18036955m
chr5L:62001026..62001050 21/25 unknown
tropicalis 10.0 Chr7:31020927..31020951 24/25 Antisense target fgf8
Publications
First: Ectopic EphA4 receptor induces posterior protrusions via FGF signaling in Xenopus embryos., Mol Biol Cell 2004                  
Most recent: FGF is essential for both condensation and mesenchymal-epithelial transition stages of pronephric kidney tubule development., Dev Biol 2006                      
View All Papers