Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249503

Morpholino Name: fgf8 MO4
Synonyms: FGF8MO
mRNA Target: fgf8

Morpholino Type: splice blocking morpholino
Sequence:
5' CAATTTACCTGGGCTTGTAGGCAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' TCTGCCTACAAGCCCAGGTAAATTG 3' ||||||||||||||||||||||||| 3' AGACGGATGTTCGGGTCCATTTAAC 5' 5' TCTGCCTACAAGCCCAGGTAAAGTG 3' |||||||||||||||||||||| || 3' AGACGGATGTTCGGGTCCATTTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1915:814720..814744 24/25 Antisense off-target Xelaev16024201m
Scaffold33483:255202..255226 24/25 Antisense target fgf8.L
tropicalis 7.1 scaffold_7:25554412..25554436 25/25 Antisense target fgf8
scaffold_7:73574089..73574113 21/25 Antisense off-target drd2
Publications
First: Reiterative AP2a activity controls sequential steps in the neural crest gene regulatory network., Proc Natl Acad Sci U S A 2011          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556