Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249503

Morpholino Name: fgf8 MO4
Synonyms: FGF8MO
Target mRNA: fgf8

Morpholino Type: splice blocking morpholino
Sequence: 5' CAATTTACCTGGGCTTGTAGGCAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' TCTGCCTACAAGCCCAGGTAAATTG 3' ||||||||||||||||||||||||| 3' AGACGGATGTTCGGGTCCATTTAAC 5' 5' TCTGCCTACAAGCCCAGGTAAAGTG 3' |||||||||||||||||||||| || 3' AGACGGATGTTCGGGTCCATTTAAC 5' 5' TCTGCCTGCAAGCCCAGGTAAATTG 3' ||||||| ||||||||||||||||| 3' AGACGGATGTTCGGGTCCATTTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:25383551..25383575 24/25 Antisense target fgf8.L
chr7S:20490307..20490331 24/25 Antisense target fgf8.S
chr7S:20490307..20490331 24/25 Antisense off-target Xelaev18036955m
tropicalis 10.0 Chr7:31020788..31020812 25/25 Antisense target fgf8
Chr7:86246220..86246244 21/25 Antisense off-target drd2
Publications
First: Reiterative AP2a activity controls sequential steps in the neural crest gene regulatory network., Proc Natl Acad Sci U S A 2011          
Most recent:
View All Papers