Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249505

Morpholino Name: fgfr1 MO2
Synonyms: FGFR1b MO
mRNA Target: fgfr1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGGACATTCCGGAGAACATCCCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' TTGGGATGTTCTCCGGAAGGTCCCT 3' |||||||||||||||||| |||||| 3' AACCCTACAAGAGGCCTTACAGGGA 5' 5' TTGGGATGTTCTCCGGAAGGTCCCT 3' |||||||||||||||||| |||||| 3' AACCCTACAAGAGGCCTTACAGGGA 5' 5' TTGGGATGTTCTCCGGAAGGTCCCT 3' |||||||||||||||||| |||||| 3' AACCCTACAAGAGGCCTTACAGGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:774316..774340 24/25 Antisense target fgfr1.L
Scaffold59267:1480771..1480795 24/25 Antisense target fgfr1.S
Scaffold35361:2216942..2216966 21/25 unknown
tropicalis 7.1 scaffold_3:6828719..6828743 24/25 Antisense target fgfr1
Publications
First: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556