Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249506

Morpholino Name: fgfr1 MO3
Synonyms: XFGFR1 MO, XFGFR1-MO
mRNA Target: fgfr1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGGAGAACATCCCAAGTTGGCTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CTAGCCAACTTGGGATGTTCTCCGG 3' ||||||||||||||||||||||||| 3' GATCGGTTGAACCCTACAAGAGGCC 5' 5' CTAGCCAACTTGGGATGTTCTCCGG 3' ||||||||||||||||||||||||| 3' GATCGGTTGAACCCTACAAGAGGCC 5' 5' CTAGCCAACTTGGGATGTTCTCCGG 3' ||||||||||||||||||||||||| 3' GATCGGTTGAACCCTACAAGAGGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:774325..774349 25/25 Antisense target fgfr1.L
Scaffold59267:1480762..1480786 25/25 Antisense target fgfr1.S
Scaffold7440:750043..750067 21/25 unknown
tropicalis 7.1 scaffold_3:6828728..6828752 25/25 Antisense target fgfr1
Publications
First: Competition for ligands between FGFR1 and FGFR4 regulates Xenopus neural development., Int J Dev Biol 2010            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556