Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249508

Morpholino Name: fgfr4 MO2
Synonyms: FGFR4b MO
mRNA Target: fgfr4

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCCAGACATGGCTGGCGCGTATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25 22/25
genomic

MO
5' CACACGTGCCAGTCATGTCTGGATC 3' || ||| ||||| |||||||||||| 3' GTATGCGCGGTCGGTACAGACCTAG 5' 5' CATACGCGCCAGCCACGTCTGGATC 3' ||||||||||||||| ||||||||| 3' GTATGCGCGGTCGGTACAGACCTAG 5' 5' CATACGCACCAGTAATGTCTGGATC 3' ||||||| |||| ||||||||||| 3' GTATGCGCGGTCGGTACAGACCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100253:1242726..1242750 24/25 Antisense target fgfr4.L
Scaffold5925:11212917..11212941 22/25 Antisense target fgfr4.S
tropicalis 7.1 scaffold_3:74881105..74881129 22/25 Antisense target fgfr4
Publications
First: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556