Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249509

Morpholino Name: fgfr4 MO3
Synonyms: XFGFR4A MO, XFGFR4a
mRNA Target: fgfr4

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTTCTTCTTACAGATCCAGACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25 22/25
genomic

MO
5' CATGTCTGGATCCGTAAAAAGAAGC 3' |||||||||||| |||| ||||||| 3' GTACAGACCTAGACATTCTTCTTCG 5' 5' CACGTCTGGATCTGTAAGAAGAAGC 3' || |||||||||||||||||||||| 3' GTACAGACCTAGACATTCTTCTTCG 5' 5' AATGTCTGGATCCATAAGAAGAAGC 3' ||||||||||| ||||||||||| 3' GTACAGACCTAGACATTCTTCTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100253:1242713..1242737 24/25 Antisense target fgfr4.L
Scaffold5925:11212930..11212954 22/25 Antisense target fgfr4.S
Scaffold356123:566402..566426 21/25 Antisense off-target Xelaev16046657m
tropicalis 7.1 scaffold_3:74881118..74881142 23/25 Antisense target fgfr4
scaffold_2:101368821..101368845 21/25 unknown
scaffold_6:67329003..67329027 21/25 unknown
Publications
First: Competition for ligands between FGFR1 and FGFR4 regulates Xenopus neural development., Int J Dev Biol 2010            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556