Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249527

Morpholino Name: fn1 MO1
Synonyms: Fn1.S-MO, XFN1 MO, XFN1.MO
mRNA Target: fn1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCTCTGGAGACTATAAAAGCCAAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATTGGCTTTTATAGTCTCCAGAGCG 3' ||||||||||||||||||||||||| 3' TAACCGAAAATATCAGAGGTCTCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:73634557..73634581 25/25 Antisense target fn1.L
chr7S:68559440..68559464 21/25 unknown
tropicalis 10.0 Chr2:52021062..52021086 21/25 Antisense off-target plxna2
Chr6:119737797..119737821 21/25 Antisense off-target c8orf34
Publications
First: Integrin alpha5beta1 and fibronectin regulate polarized cell protrusions required for Xenopus convergence and extension., Curr Biol 2006                  
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration., Development 2018                      
View All Papers