Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249528

Morpholino Name: fn1 MO2
Synonyms: Fn1.L-MO, XFN2 MO, XFN2.MO
mRNA Target: fn1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCATTTTTCAAACGCTCTGAAGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold291180:372093..372117 21/25 unknown
Publications
First: Integrin alpha5beta1 and fibronectin regulate polarized cell protrusions required for Xenopus convergence and extension., Curr Biol 2006                  
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration., Development 2018                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556