Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249531

Morpholino Name: foxb1 MO1
Synonyms:
mRNA Target: foxb1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGTGTTTCTTCCAGGACGAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||||||||| |||||||||| 3' TACGGAGCAGGACCTTCTTTGTGGA 5' 5' ATGCCTCGTCCTGGAAGAAACACCT 3' ||||||||||||||||||||||||| 3' TACGGAGCAGGACCTTCTTTGTGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold38656:1756666..1756690 25/25 Antisense target foxb1.S
Scaffold59883:5102130..5102154 24/25 Antisense off-target Xelaev16065384m
tropicalis 7.1 scaffold_9:54870444..54870468 24/25 Antisense target foxb1
Publications
First: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556