Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249531

Morpholino Name: foxb1 MO1
Synonyms:
Target mRNA: foxb1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGTGTTTCTTCCAGGACGAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||||||||| |||||||||| 3' TACGGAGCAGGACCTTCTTTGTGGA 5' 5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||||||||| |||||||||| 3' TACGGAGCAGGACCTTCTTTGTGGA 5' 5' ATGCCTCGTCCTGGAAGAAACACCT 3' ||||||||||||||||||||||||| 3' TACGGAGCAGGACCTTCTTTGTGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:56202837..56202861 25/25 Antisense target foxb1.S
chr3L:86370669..86370693 24/25 Antisense target foxb1.L
tropicalis 10.0 Chr3:96222984..96223008 24/25 Antisense target foxb1
Publications
First: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
Most recent:
View All Papers