Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249532

Morpholino Name: foxb1 MO2
Synonyms:
mRNA Target: foxb1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGTGTTTCTCGCAGGGCGAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||| |||| ||||||||||| 3' TACGGAGCGGGACGCTCTTTGTGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold59883:5102130..5102154 23/25 Antisense off-target Xelaev16065384m
Scaffold157205:710983..711007 21/25 Sense off-target Xelaev16016582m
Scaffold337825:4933861..4933885 21/25 Sense off-target Xelaev16044537m
tropicalis 7.1 scaffold_9:54870444..54870468 23/25 Antisense target foxb1
scaffold_1:9189395..9189419 21/25 unknown
scaffold_1:9189955..9189979 21/25 unknown
scaffold_1:9190936..9190960 21/25 unknown
scaffold_1:9191496..9191520 21/25 unknown
scaffold_1:9192477..9192501 21/25 unknown
scaffold_1:9193037..9193061 21/25 unknown
scaffold_1:9194018..9194042 21/25 unknown
scaffold_1:9195559..9195583 21/25 unknown
scaffold_1:9196119..9196143 21/25 unknown
scaffold_1:9197100..9197124 21/25 unknown
scaffold_1:9197660..9197684 21/25 unknown
scaffold_1:9198641..9198665 21/25 unknown
scaffold_1:9199201..9199225 21/25 unknown
scaffold_1:9200182..9200206 21/25 unknown
scaffold_1:9200742..9200766 21/25 unknown
scaffold_1:9201723..9201747 21/25 unknown
scaffold_1:9202296..9202320 21/25 unknown
scaffold_1:9203277..9203301 21/25 unknown
scaffold_1:9203837..9203861 21/25 unknown
scaffold_1:9204818..9204842 21/25 unknown
scaffold_1:9205378..9205402 21/25 unknown
scaffold_1:9206359..9206383 21/25 unknown
scaffold_1:9206919..9206943 21/25 unknown
scaffold_1:9207900..9207924 21/25 unknown
scaffold_1:9208460..9208484 21/25 unknown
scaffold_1:9209441..9209465 21/25 unknown
scaffold_1:9210001..9210025 21/25 unknown
scaffold_1:9210982..9211006 21/25 unknown
scaffold_1:9211542..9211566 21/25 unknown
scaffold_1:9212523..9212547 21/25 unknown
scaffold_1:9213083..9213107 21/25 unknown
scaffold_1:9214064..9214088 21/25 unknown
scaffold_1:9214624..9214648 21/25 unknown
scaffold_1:9215605..9215629 21/25 unknown
scaffold_1:9216165..9216189 21/25 unknown
scaffold_1:9217146..9217170 21/25 unknown
scaffold_1:9217705..9217729 21/25 unknown
scaffold_1:9218686..9218710 21/25 unknown
scaffold_1:9219245..9219269 21/25 unknown
scaffold_1:9220226..9220250 21/25 unknown
scaffold_1:9220786..9220810 21/25 unknown
scaffold_1:9221767..9221791 21/25 unknown
scaffold_1:9222327..9222351 21/25 unknown
scaffold_1:9223308..9223332 21/25 unknown
scaffold_1:9223868..9223892 21/25 unknown
scaffold_1:9224849..9224873 21/25 unknown
scaffold_1:9225409..9225433 21/25 unknown
scaffold_1:9226390..9226414 21/25 unknown
scaffold_1:9226950..9226974 21/25 unknown
scaffold_1:9227931..9227955 21/25 unknown
scaffold_1:9228491..9228515 21/25 unknown
scaffold_1:9229472..9229496 21/25 unknown
scaffold_1:9230032..9230056 21/25 unknown
scaffold_1:9231013..9231037 21/25 unknown
scaffold_1:9231573..9231597 21/25 unknown
scaffold_1:9232554..9232578 21/25 unknown
scaffold_1:9233114..9233138 21/25 unknown
scaffold_1:9234095..9234119 21/25 unknown
scaffold_1:9234655..9234679 21/25 unknown
scaffold_1:9235636..9235660 21/25 unknown
scaffold_1:9236617..9236641 21/25 unknown
scaffold_1:9237177..9237201 21/25 unknown
scaffold_1:9261323..9261347 21/25 Sense off-target slc38a9
scaffold_1:9263928..9263952 21/25 Sense off-target slc38a9
scaffold_1:9269413..9269437 21/25 Sense off-target slc38a9
scaffold_4:71543005..71543029 21/25 Sense off-target cfh
Publications
First: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556