Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249532

Morpholino Name: foxb1 MO2
Synonyms:
Target mRNA: foxb1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGTGTTTCTCGCAGGGCGAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 23/25
genomic

MO
5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||| |||| ||||||||||| 3' TACGGAGCGGGACGCTCTTTGTGGA 5' 5' ATGCCTCGTCCTGGGAGAAACACCT 3' |||||||| |||| ||||||||||| 3' TACGGAGCGGGACGCTCTTTGTGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:86370669..86370693 23/25 Antisense target foxb1.L
chr1L:195338145..195338169 21/25 Sense off-target slc38a9.L
chr1L:195338954..195338978 21/25 Sense off-target slc38a9.L
chr1L:195341097..195341121 21/25 Sense off-target slc38a9.L
chr1L:195347140..195347164 21/25 Sense off-target slc38a9.L
chr1L:195349485..195349509 21/25 Sense off-target slc38a9.L
chr1L:195362762..195362786 21/25 Sense off-target slc38a9.L
chr1L:195367272..195367296 21/25 Sense off-target slc38a9.L
chr1S:160259432..160259456 21/25 Sense off-target slc38a9.S
chr1S:160279652..160279676 21/25 Sense off-target slc38a9.S
chr1S:160279652..160279676 21/25 Sense off-target LOC100335115
tropicalis 10.0 Chr3:96222984..96223008 23/25 Antisense target foxb1
Chr1:191412166..191412190 21/25 Sense off-target LOC116408537
Chr1:191412726..191412750 21/25 Sense off-target LOC116408535
Chr1:191413707..191413731 21/25 Sense off-target LOC116408553
Chr1:191414267..191414291 21/25 Sense off-target LOC116408528
Chr1:191415248..191415272 21/25 Sense off-target LOC116408564
Chr1:191415808..191415832 21/25 Sense off-target LOC116408489
Chr1:191416367..191416391 21/25 Sense off-target LOC116408529
Chr1:191417348..191417372 21/25 Sense off-target LOC116408500
Chr1:191417908..191417932 21/25 Sense off-target LOC116408530
Chr1:191418889..191418913 21/25 Sense off-target LOC116408511
Chr1:191419449..191419473 21/25 Sense off-target LOC116408532
Chr1:191420430..191420454 21/25 Sense off-target LOC116408522
Chr1:191420990..191421014 21/25 Sense off-target LOC116408533
Chr1:191421971..191421995 21/25 Sense off-target LOC116408525
Chr1:191422531..191422555 21/25 Sense off-target LOC116408534
Chr1:191447273..191447297 21/25 Sense off-target slc38a9
Chr1:191447273..191447297 21/25 Sense off-target LOC116408531
Chr1:191449884..191449908 21/25 Sense off-target slc38a9
Chr1:191449884..191449908 21/25 Sense off-target LOC116408526
Chr1:191455369..191455393 21/25 Sense off-target slc38a9
Chr1:191455369..191455393 21/25 Sense off-target LOC116408527
Publications
First: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
Most recent:
View All Papers