Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249533

Morpholino Name: foxb1 MO3
Synonyms:
Target mRNA: foxb1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAGGCATCTTCACTGGCAAACAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 23/25
genomic

MO
5' CCAGTTTGCAAGTGAAGATGCCTCG 3' || |||||| ||||||||||||||| 3' GGACAAACGGTCACTTCTACGGAGC 5' 5' CCTGTTTGCAAGTGAAGATGCCTCG 3' ||||||||| ||||||||||||||| 3' GGACAAACGGTCACTTCTACGGAGC 5' 5' CCTGTTTACAAGTGAAGATGCCTCG 3' ||||||| | ||||||||||||||| 3' GGACAAACGGTCACTTCTACGGAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:86370686..86370710 24/25 Antisense target foxb1.L
chr3S:56202820..56202844 23/25 Antisense target foxb1.S
chr1S:164702152..164702176 21/25 Sense off-target c7.S
tropicalis 10.0 Chr3:96223001..96223025 23/25 Antisense target foxb1
Chr6:77072870..77072894 21/25 unknown
Publications
First: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
Most recent:
View All Papers