Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249535

Morpholino Name: foxc1 MO1
Synonyms: FoxC1
mRNA Target: foxc1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCGCCTGCATGGCTCCTCCGCCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GAGGCGGAGGAGCCATGCAGGCGCG 3' ||||||||||||||||||||||||| 3' CTCCGCCTCCTCGGTACGTCCGCGC 5' 5' GAGGCGGAGGAGCCATGCAGGCGCG 3' ||||||||||||||||||||||||| 3' CTCCGCCTCCTCGGTACGTCCGCGC 5' 5' GAGGCGGAGGAGCCATGCAGGCGCG 3' ||||||||||||||||||||||||| 3' CTCCGCCTCCTCGGTACGTCCGCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128723:675336..675360 25/25 Antisense target foxc1.L
Scaffold274508:747686..747710 25/25 Antisense target foxc1.S
Scaffold69443:279649..279673 24/25 Antisense off-target Xelaev16068777m
Scaffold63404:2617699..2617723 23/25 Antisense off-target nudcd1.S
Scaffold64233:227421..227445 23/25 unknown
Scaffold78587:2030773..2030797 23/25 Antisense off-target cblb.S
Scaffold14976:171027..171051 22/25 unknown
Scaffold163107:1497184..1497208 22/25 Sense off-target Xelaev16018163m
Scaffold167628:3742855..3742879 22/25 Antisense off-target Xelaev16019225m
Scaffold17836:1887663..1887687 22/25 Antisense off-target Xelaev16021551m
Scaffold20052:428377..428401 22/25 unknown
Scaffold21603:2332762..2332786 22/25 unknown
Scaffold35086:304719..304743 22/25 unknown
Scaffold35606:68..92 22/25 unknown
Scaffold43242:4084882..4084906 22/25 unknown
Scaffold4411:41139..41163 22/25 Sense off-target Xelaev16054441m
Scaffold47026:337619..337643 22/25 unknown
Scaffold48253:5458160..5458184 22/25 unknown
Scaffold70754:211670..211694 22/25 Antisense off-target march6.L
Scaffold109418:1002353..1002377 21/25 unknown
Scaffold112554:1016128..1016152 21/25 unknown
Scaffold134022:236850..236874 21/25 Sense off-target herpud2.L
Scaffold155605:334270..334294 21/25 unknown
Scaffold162663:688735..688759 21/25 Sense off-target smpd4.L
Scaffold174416:2564..2588 21/25 unknown
Scaffold18239:512422..512446 21/25 Antisense off-target Xelaev16022556m
Scaffold275342:4105546..4105570 21/25 Antisense off-target Xelaev16037855m
Scaffold287959:3327717..3327741 21/25 unknown
Scaffold30483:1072911..1072935 21/25 unknown
Scaffold32212:8448980..8449004 21/25 Antisense off-target Xelaev16042915m
Scaffold3737:370831..370855 21/25 unknown
Scaffold37703:1643..1667 21/25 unknown
Scaffold42281:293751..293775 21/25 Antisense off-target Xelaev16052495m
Scaffold46631:210626..210650 21/25 unknown
Scaffold7103:112566..112590 21/25 unknown
tropicalis 7.1 scaffold_6:63058419..63058443 25/25 Antisense target foxc1
Publications
First: The role of FoxC1 in early Xenopus development., Dev Dyn 2007          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556