Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249536

Morpholino Name: foxc2 MO1
Synonyms: foxc2-MO
Target mRNA: foxc2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACGCGCCTGCATCATTAGTGCTGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' TTCAGCACCAATGATGCAGGCGCGT 3' |||||||| |||||||||||||||| 3' AAGTCGTGATTACTACGTCCGCGCA 5' 5' TTCAGCACCAATGATGCAGGCGCGT 3' |||||||| |||||||||||||||| 3' AAGTCGTGATTACTACGTCCGCGCA 5' 5' TTCAGCACTAATGATGCAGGCGCGT 3' ||||||||||||||||||||||||| 3' AAGTCGTGATTACTACGTCCGCGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:42004561..42004585 25/25 Antisense target foxc2.S
chr4L:50216896..50216920 24/25 Antisense target foxc2.L
chr4L:119503120..119503144 23/25 Antisense off-target rnf123.L
chr1S:31632022..31632046 21/25 Antisense off-target pdgfrl.S
tropicalis 10.0 Chr4:61560636..61560660 24/25 Antisense target foxc2
Chr3:95178986..95179010 22/25 Antisense off-target slc27a3
Publications
First: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
Most recent:
View All Papers