Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249537

Morpholino Name: foxd3 MO1
Synonyms: Foxd3 MO, Foxd3-MO
Target mRNA: foxd3

Morpholino Type: uncategorized morpholino
Sequence: 5' CACTGCCGCTGCCTGACAGGGTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGACCCTGTCAGGCAGCAGCAGTG 3' |||||||||||||||||| |||||| 3' TACTGGGACAGTCCGTCGCCGTCAC 5' 5' ATGACCCTGTCAGGCAGCGGCAGTG 3' ||||||||||||||||||||||||| 3' TACTGGGACAGTCCGTCGCCGTCAC 5' 5' ATGACCCTGTCAAGCAGCGGCAGTG 3' |||||||||||| |||||||||||| 3' TACTGGGACAGTCCGTCGCCGTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:74584144..74584168 25/25 Antisense target foxd3.L
chr4S:59543484..59543508 24/25 Antisense target foxd3.S
chr6S:11354361..11354385 21/25 unknown
tropicalis 10.0 Chr4:85212637..85212661 24/25 Antisense target foxd3
Publications
First: Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus ectoderm., Development 2005            
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                                              
View All Papers