Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249537

Morpholino Name: foxd3 MO1
Synonyms: Foxd3 MO, Foxd3-MO
mRNA Target: foxd3

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTGCCGCTGCCTGACAGGGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGACCCTGTCAGGCAGCAGCAGTG 3' |||||||||||||||||| |||||| 3' TACTGGGACAGTCCGTCGCCGTCAC 5' 5' ATGACCCTGTCAGGCAGCGGCAGTG 3' ||||||||||||||||||||||||| 3' TACTGGGACAGTCCGTCGCCGTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold155039:2086266..2086290 25/25 Antisense target foxd3.L
Scaffold53042:1037979..1038003 24/25 Antisense off-target Xelaev16060913m
Scaffold52573:9163188..9163212 21/25 unknown
tropicalis 7.1 scaffold_4:95140621..95140645 24/25 Antisense target foxd3
Publications
First: Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus ectoderm., Development 2005            
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556