Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249538

Morpholino Name: foxd3 MO2
Synonyms: FoxD3MO
Target mRNA: foxd3

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGGGTCATTCCAGTTACGCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/24 24/24
genomic

MO
5' GACCCGTAGCTGGAATGACCCTGT 3' | |||| ||||||||||||||| 3' CCTCGCATTGACCTTACTGGGACA 5' 5' GGAGCGTAACTGGAATGACCCTGT 3' |||||||||||||||||||||||| 3' CCTCGCATTGACCTTACTGGGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:74584159..74584182 24/24 Antisense target foxd3.L
tropicalis 10.0 Chr4:85212652..85212675 20/24 Antisense target foxd3
Chr3:82218453..82218476 20/24 unknown
Publications
First: FoxD3 regulation of Nodal in the Spemann organizer is essential for Xenopus dorsal mesoderm development., Development 2006                      
Most recent:
View All Papers