Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249543

Morpholino Name: foxh1 MO1
Synonyms: FoxH1, anti-XFast-1
mRNA Target: foxh1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTACAGACTGGAGGGGTCTCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAGAGACCCCTCCAGTCTGTACG 3' |||||||||||||||||||||||| 3' TACTCTCTGGGGAGGTCAGACATGA 5' 5' ATGAGAGACCCCTCCAGTCTGTACT 3' ||||||||||||||||||||||||| 3' TACTCTCTGGGGAGGTCAGACATGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold135348:1963569..1963593 25/25 Antisense target foxh1.L
Scaffold86347:403275..403299 21/25 unknown
tropicalis 7.1 scaffold_119:31480..31504 24/25 Antisense target foxh1
Publications
First: The role of a Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription factor in activin/nodal signaling., Genes Dev 2002      
Most recent: A novel Xenopus Smad-interacting forkhead transcription factor (XFast-3) cooperates with XFast-1 in regulating gastrulation movements., Development 2002      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556