Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249546

Morpholino Name: foxi1 MO2
Synonyms: foxi1e SP MO, sp MO
mRNA Target: foxi1

Morpholino Type:
Sequence:
5' AATGAATGGTTTTTACCTGGATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGATCCAGGTAAAAACCATTCATT 3' ||||||||||||||||||||||||| 3' TACTAGGTCCATTTTTGGTAAGTAA 5' 5' ATGATCCAGGTAATAACCATTCATT 3' ||||||||||||| ||||||||||| 3' TACTAGGTCCATTTTTGGTAAGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold179377:927119-927143 24/25 Antisense target foxi1.L
Scaffold48253:1492909-1492933 23/25 Antisense off-target Xelaev16057560m
Scaffold109184:547258-547282 22/25 unknown
Scaffold268638:1225401-1225425 22/25 Sense off-target Xelaev16036339m
Scaffold96712:868339-868363 21/25 Antisense off-target Xelaev16080022m
tropicalis 7.1 scaffold_3:60402168-60402192 25/25 Antisense target foxi1
scaffold_4:108195693-108195717 22/25 unknown
scaffold_2:114844273-114844297 21/25 unknown
scaffold_2:116813080-116813104 21/25 unknown
Publications
First: Embryonic frog epidermis: a model for the study of cell-cell interactions in the development of mucociliary disease. [Dis Model Mech 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556