Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249554

Morpholino Name: foxi4.2 MO1
Synonyms: Xfoxi1a MO, Xfoxi1a-MO
mRNA Target: foxi4.2

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCAGCGGCTTCTGCTCTTTCCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGGAAAGAGCAGAAGCCGCTGATC 3' ||||||||||||||||||||||||| 3' ACCCTTTCTCGTCTTCGGCGACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1168:1513669..1513693 25/25 Antisense target foxi4.2.S
Scaffold13576:319856..319880 21/25 unknown
Scaffold14978:660670..660694 21/25 unknown
Scaffold29621:2586529..2586553 21/25 unknown
tropicalis 7.1 scaffold_10:2176982..2177006 21/25 Antisense off-target map2k4
Publications
First: An essential role of Xenopus Foxi1a for ventral specification of the cephalic ectoderm during gastrulation., Development 2005                        
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556