Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249554

Morpholino Name: foxi4.2 MO1
Synonyms: Xfoxi1a MO, Xfoxi1a-MO
Target mRNA: foxi4.2

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCAGCGGCTTCTGCTCTTTCCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGGAAAGAGCAGAAGCCGCTGATC 3' ||||||||||||||||||||||||| 3' ACCCTTTCTCGTCTTCGGCGACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:9128464..9128488 25/25 Antisense target foxi4.2.S
chr2L:139849420..139849444 21/25 Sense off-target baz2a.L
chr1L:132490461..132490485 21/25 unknown
chr6S:86702774..86702798 21/25 unknown
tropicalis 10.0 Chr10:46963727..46963751 21/25 Antisense off-target map2k4
Chr7:130590417..130590441 21/25 unknown
Publications
First: An essential role of Xenopus Foxi1a for ventral specification of the cephalic ectoderm during gastrulation., Development 2005                        
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers