Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249555

Morpholino Name: foxi4.2 MO2
Synonyms: Xfoxi1b MO, Xfoxi1b-MO
Target mRNA: foxi4.2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTCATCTCGCTCACTGGCTAATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: An essential role of Xenopus Foxi1a for ventral specification of the cephalic ectoderm during gastrulation., Development 2005                        
Most recent:
View All Papers