Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249556

Morpholino Name: foxj1 MO1
Synonyms: Foxj1MOatg, foxj1, foxj1MO, xFoxJ1 MOATG
mRNA Target: foxj1

Morpholino Type:
Sequence:
5' GCAGGTCAAACATTAATAAAGCCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' CAGGCTTTATTAATGTTTGACCTGC 3' ||||||||||||||||||||||| 3' TCCCGAAATAATTACAAACTGGACG 5' 5' AGGGCTTTATTAATGTTTGACCTGC 3' ||||||||||||||||||||||||| 3' TCCCGAAATAATTACAAACTGGACG 5' 5' AGGGCTTTATTAATGTTTGACCTGC 3' ||||||||||||||||||||||||| 3' TCCCGAAATAATTACAAACTGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106323:1174001-1174025 25/25 Antisense target foxj1.S
Scaffold71264:621801-621825 25/25 Antisense target foxj1.L
Scaffold7479:3002170-3002194 22/25 Antisense off-target Xelaev16071455m
Scaffold107078:689706-689730 21/25 unknown
Scaffold230826:39721-39745 21/25 unknown
Scaffold27036:9540221-9540245 21/25 Antisense off-target Xelaev16036628m
tropicalis 7.1 scaffold_10:4037240-4037264 23/25 Antisense target foxj1
Publications
First: The forkhead protein Foxj1 specifies node-like cilia in Xenopus and zebrafish embryos. [Nat Genet 2008]
Most recent: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus. [Dev Biol 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556