Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249558

Morpholino Name: foxm1 MO1
Synonyms: FoxM1-MO
mRNA Target: foxm1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTTGTTCTCATGGTGTGACGGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGCCGTCACACCATGAGAACAAGC 3' ||||||||||||||||||||||||| 3' CTCGGCAGTGTGGTACTCTTGTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:10268181..10268205 25/25 Antisense target foxm1.S
chr9_10S:13469141..13469165 21/25 Antisense off-target osbpl2.S
Publications
First: FoxM1-driven cell division is required for neuronal differentiation in early Xenopus embryos., Development 2008            
Most recent:
View All Papers