Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249559

Morpholino Name: foxn3 MO1
Synonyms: FoxN3
mRNA Target: foxn3

Morpholino Type: uncategorized morpholino
Sequence:
5' TACTAGGAGGCATGACTGGACCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/23 23/23 23/23
genomic

MO
5' GGGTCCAATCATGCCTCCTAGTA 3' ||||||| ||||||||||||||| 3' CCCAGGTCAGTACGGAGGATCAT 5' 5' GGGTCCAGTCATGCCTCCTAGTA 3' ||||||||||||||||||||||| 3' CCCAGGTCAGTACGGAGGATCAT 5' 5' GGGTCCAGTCATGCCTCCTAGTA 3' ||||||||||||||||||||||| 3' CCCAGGTCAGTACGGAGGATCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:63873919..63873941 23/23 Antisense target foxn3.L
chr8S:21798705..21798727 23/23 Antisense target foxn3.S
chr1L:104904862..104904884 19/23 Antisense off-target ncbp1.L
chr1S:92367654..92367676 19/23 Antisense off-target ncbp1.S
tropicalis 10.0 Chr8:86326636..86326658 22/23 Antisense target foxn3
Publications
First: FoxN3 is required for craniofacial and eye development of Xenopus laevis., Dev Dyn 2007                              
Most recent:
View All Papers