Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249560

Morpholino Name: foxn3 MO2
Synonyms: FoxN3
mRNA Target: foxn3

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTAGGAGGGCATGACTGGACCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: A role for FoxN3 in the development of cranial cartilages and muscles in Xenopus laevis (Amphibia: Anura: Pipidae) with special emphasis on the novel rostral cartilages., J Anat 2011  
Most recent: FoxN3 is necessary for the development of the interatrial septum, the ventricular trabeculae and the muscles at the head/trunk interface in the African clawed frog, Xenopus laevis (Lissamphibia: Anura: Pipidae)., Dev Dyn 2019            
View All Papers