Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249561

Morpholino Name: foxo1 MO1
Synonyms: FoxO1MO
Target mRNA: foxo1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGAGCCTCAGCCATGGTTTCAACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTTGAAACCATGGCTGAGGCTCCT 3' ||||||||||||||||||||||||| 3' TCAACTTTGGTACCGACTCCGAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:153093399..153093423 25/25 Antisense target foxo1.L
tropicalis 10.0 Chr1:92650866..92650890 21/25 unknown
Publications
First: FoxO genes are dispensable during gastrulation but required for late embryogenesis in Xenopus laevis., Dev Biol 2010                    
Most recent:
View All Papers