Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249564

Morpholino Name: foxo6 MO1
Synonyms: Fox06MO, FoxO6MO
Target mRNA: foxo6

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTCCAGCTTCTCCATTACTTGTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TACAAGTAATGGAGAAGCTGGAAGC 3' ||||||||||||||||||||||||| 3' ATGTTCATTACCTCTTCGACCTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:64455117..64455141 25/25 Antisense target foxo6.S
chr1S:138516814..138516838 21/25 Sense off-target kremen1.S
chr1L:113901600..113901624 23/25 unknown
chr1S:93725857..93725881 23/25 unknown
Publications
First: FoxO genes are dispensable during gastrulation but required for late embryogenesis in Xenopus laevis., Dev Biol 2010                    
Most recent:
View All Papers