Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249569

Morpholino Name: frzb MO1
Synonyms: frzbMO
mRNA Target: frzb

Morpholino Type: uncategorized morpholino
Sequence:
5' AGACATTGTTATTCTGCCCAACCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' TAGCTTGGGCAGGATAACAATGTCT 3' || |||||||| |||||||||||| 3' GTCCAACCCGTCTTATTGTTACAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43242:1119624..1119648 25/25 Antisense off-target Xelaev16053304m
tropicalis 7.1 scaffold_9:49558808..49558832 22/25 Antisense target frzb
Publications
First: Secreted Frizzled-related proteins enhance the diffusion of Wnt ligands and expand their signalling range., Development 2009    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556