Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249570

Morpholino Name: frzb2 MO1
Synonyms: cresMO
mRNA Target: frzb2

Morpholino Type: uncategorized morpholino
Sequence:
5' GAAGAACTACTTACTTCTACGGGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TACCCGTAGAAGTAAGTAGTTCTTC 3' ||||||||||||||||||||||||| 3' ATGGGCATCTTCATTCATCAAGAAG 5' 5' TACCCGTAGAAGTAAGTAGTTCTTC 3' ||||||||||||||||||||||||| 3' ATGGGCATCTTCATTCATCAAGAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:131757750..131757774 25/25 Antisense target frzb2.L
chr4L:131757750..131757774 25/25 Sense off-target p4htm.L
chr4S:109443956..109443980 25/25 Sense off-target p4htm.S
chr4S:109443956..109443980 25/25 Antisense target frzb2.S
Publications
First: Role of crescent in convergent extension movements by modulating Wnt signaling in early Xenopus embryogenesis., Mech Dev 2005                      
Most recent: Secreted Frizzled-related Protein 2 (sFRP2) Redirects Non-canonical Wnt Signaling from Fz7 to Ror2 during Vertebrate Gastrulation., J Biol Chem 2016                
View All Papers