Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249571

Morpholino Name: frzb2 MO2
Synonyms: Crescent MO
mRNA Target: frzb2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCTGACACACCTGAGGGCCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold189728:905793..905815 20/23 unknown
Scaffold221007:4533331..4533353 19/23 unknown
Scaffold31653:5212896..5212918 19/23 unknown
tropicalis 7.1 scaffold_10:1017301..1017323 20/23 unknown
scaffold_3:23690469..23690491 19/23 Antisense off-target pdia3
scaffold_3:81931930..81931952 19/23 unknown
scaffold_6:23775970..23775992 19/23 Antisense off-target ripk2
scaffold_9:64566262..64566284 19/23 unknown
Publications
First: Dorsal-ventral patterning: Crescent is a dorsally secreted Frizzled-related protein that competitively inhibits Tolloid proteases., Dev Biol 2011            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556