Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249571

Morpholino Name: frzb2 MO2
Synonyms: Crescent MO
mRNA Target: frzb2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCTGACACACCTGAGGGCCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:3406542..3406564 20/23 unknown
chr1S:25842385..25842407 19/23 Antisense off-target limch1.S
chr2S:110486795..110486817 19/23 unknown
tropicalis 10.0 Chr10:48472857..48472879 20/23 unknown
Chr3:107445646..107445668 19/23 Antisense off-target pdia3
Chr3:53195669..53195691 19/23 unknown
Chr6:126049462..126049484 19/23 Antisense off-target ripk2
Chr9:35257262..35257284 19/23 unknown
Publications
First: Dorsal-ventral patterning: Crescent is a dorsally secreted Frizzled-related protein that competitively inhibits Tolloid proteases., Dev Biol 2011            
Most recent:
View All Papers