Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249573

Morpholino Name: fst MO2
Synonyms: Follistatin MO, Follustatub MO
Target mRNA: fst

Morpholino Type: uncategorized morpholino
Sequence: 5' CATTTAACATCCTCAGTGCTGGGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' CTCTCTGCACTGAGGATGTTAAATG 3' ||| | ||||||||||||||||||| 3' GAGGGTCGTGACTCCTACAATTTAC 5' 5' CTCCCAGCACTGAGGATGTTAAATG 3' ||||||||||||||||||||||||| 3' GAGGGTCGTGACTCCTACAATTTAC 5' 5' CTCCCAGCACTGAGGATGTTAAATG 3' ||||||||||||||||||||||||| 3' GAGGGTCGTGACTCCTACAATTTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:196503281..196503305 25/25 Antisense target fst.L
chr1S:161312678..161312702 25/25 Antisense target fst.S
Scaffold51:874250..874274 22/25 Sense off-target piezo1.L
tropicalis 10.0 Chr1:192430820..192430844 23/25 Antisense target fst
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent:
View All Papers