Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249579

Morpholino Name: fuz MO1
Synonyms: xfy-MO
mRNA Target: fuz

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCCACTTACTTACCGTAGGACTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29769:1272306..1272330 25/25 Antisense off-target Xelaev16039842m
Scaffold89755:722367..722391 21/25 unknown
Publications
First: Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling., Nat Genet 2006  
Most recent: The ciliopathy-associated CPLANE proteins direct basal body recruitment of intraflagellar transport machinery., Nat Genet 2016                                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556